Product Details

SNP ID: rs13294866
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.9:100579162 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATATGAGTCACATAAGTAGTTTCCT[A/G]TGTTTGATTACAAAGTCTTTTTACT
Phenotype: MIM: 603421
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: MSANTD3-TMEFF1 PubMed Links
Additional Information: For this assay, SNP(s) [rs77702409] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001018116.2		Intron			NP_001018126.1

Gene: TMEFF1
Gene Name: transmembrane protein with EGF like and two follistatin like domains 1

There are no transcripts associated with this gene.