Product Details

SNP ID: rs11777808
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22605242 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGGCTTCCGGGGAGAGGGCCCACAC[A/C]GTCTCCTCGCCGGCACCGGCCTCCT
Phenotype: MIM: 607359 MIM: 609722
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: C8orf58 PubMed Links

Gene Details

Gene: C8orf58
Gene Name: chromosome 8 open reading frame 58

There are no transcripts associated with this gene.

Gene: CCAR2
Gene Name: cell cycle and apoptosis regulator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021174.5	87	UTR 5			NP_066997.3
XM_011544603.1	87	Intron			XP_011542905.1
XM_011544604.1	87	Intron			XP_011542906.1
XM_017013717.1	87	UTR 5			XP_016869206.1

Gene: LOC107986876
Gene Name: proline-rich proteoglycan 2-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017014122.1	87	Silent Mutation			XP_016869611.1

Gene: PDLIM2
Gene Name: PDZ and LIM domain 2

There are no transcripts associated with this gene.

View Full Product Details