Product Details

SNP ID: rs339694
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:42696387 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAAAACCACCTGCCCACACTCAGGA[C/T]GCTCTGAGTTCCATCAGTCCTCTGG
Phenotype: MIM: 608116 MIM: 615340
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC13 PubMed Links

Gene Details

Gene: CCDC13
Gene Name: coiled-coil domain containing 13

There are no transcripts associated with this gene.

Gene: HHATL
Gene Name: hedgehog acyltransferase-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020707.3		Intron			NP_065758.3
XM_006713274.2		Intron			XP_006713337.1
XM_006713275.2		Intron			XP_006713338.1
XM_011533969.2		Intron			XP_011532271.1
XM_011533970.2		Intron			XP_011532272.1
XM_017006935.1		Intron			XP_016862424.1
XM_017006936.1		Intron			XP_016862425.1
XM_017006937.1		Intron			XP_016862426.1
XM_017006938.1		Intron			XP_016862427.1

Gene: KLHL40
Gene Name: kelch like family member 40

There are no transcripts associated with this gene.

View Full Product Details