Product Details

SNP ID: rs34632325
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35744754 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGGGCAGGGCTGCATGAACAGAGA[C/G]TGAGGCATGAAGGTTGGGGGTGGAA
Phenotype: MIM: 610695 MIM: 614143 MIM: 606834 MIM: 607632 MIM: 601080
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HSPB6 PubMed Links

Gene Details

Gene: HSPB6
Gene Name: heat shock protein family B (small) member 6

There are no transcripts associated with this gene.

Gene: IGFLR1
Gene Name: IGF like family receptor 1

There are no transcripts associated with this gene.

Gene: KMT2B
Gene Name: lysine methyltransferase 2B

There are no transcripts associated with this gene.

Gene: LIN37
Gene Name: lin-37 DREAM MuvB core complex component

There are no transcripts associated with this gene.

Gene: PSENEN
Gene Name: presenilin enhancer gamma-secretase subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281532.1		Intron			NP_001268461.1
NM_172341.2		Intron			NP_758844.1

Gene: U2AF1L4
Gene Name: U2 small nuclear RNA auxiliary factor 1 like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040425.2		Intron			NP_001035515.1
NM_144987.3		Intron			NP_659424.2

View Full Product Details