Product Details

SNP ID: rs11741647
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:141638887 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGGTCTAGCATAGCCCCTTGCTCC[C/G]TCTTCTCCAACCTTCTCTTGCCCTG
Phenotype: MIM: 605166 MIM: 611213
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FCHSD1 PubMed Links

Gene Details

Gene: FCHSD1
Gene Name: FCH and double SH3 domains 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033449.2		Intron			NP_258260.1
XM_005268524.4		Intron			XP_005268581.1
XM_006714803.3		Intron			XP_006714866.1
XM_011537698.2		Intron			XP_011536000.1
XM_011537700.2		Intron			XP_011536002.1
XM_011537701.2		Intron			XP_011536003.1
XM_017010013.1		Intron			XP_016865502.1

Gene: HDAC3
Gene Name: histone deacetylase 3

There are no transcripts associated with this gene.

Gene: RELL2
Gene Name: RELT like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130029.1		Intron			NP_001123501.1
NM_173828.4		Intron			NP_776189.3
XM_005268414.3		Intron			XP_005268471.1
XM_011537624.1		Intron			XP_011535926.1
XM_011537625.2		Intron			XP_011535927.1

View Full Product Details