Product Details
- SNP ID
-
rs12740591
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
29
- Location
-
Chr.1:22638510 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- CTACATGTGGTACCTGAACCTGAAG[C/T]CAAGTCAAGGTCAGTGCCCCAGAGG
- Phenotype
-
MIM: 120550
MIM: 120575
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
C1QA
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs145158391] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- C1QA
- Gene Name
- complement C1q A chain
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_015991.2 |
|
Intron |
|
|
NP_057075.1 |
- Gene
- C1QC
- Gene Name
- complement C1q C chain
There are no transcripts associated with this gene.
- Gene
- MIR6127
- Gene Name
- microRNA 6127
There are no transcripts associated with this gene.
View Full Product Details