Product Details

SNP ID: rs2427535
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63736025 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCGGCCTGCTGGCCTGGGGCGTGC[A/G]GACACTGCTGAGTGGAGACAGAGCT
Phenotype: MIM: 609809 MIM: 609493 MIM: 614639
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LIME1 PubMed Links

Gene Details

Gene: LIME1
Gene Name: Lck interacting transmembrane adaptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001305654.1	1812	UTR 5			NP_001292583.1
NM_001305655.1	1812	Intron			NP_001292584.1
NM_017806.3	1812	Intron			NP_060276.2

Gene: SLC2A4RG
Gene Name: SLC2A4 regulator

There are no transcripts associated with this gene.

Gene: ZBTB46
Gene Name: zinc finger and BTB domain containing 46

There are no transcripts associated with this gene.

Gene: ZGPAT
Gene Name: zinc finger CCCH-type and G-patch domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083113.1	1812	UTR 3			NP_001076582.1
NM_001195653.1	1812	UTR 3			NP_001182582.1
NM_001195654.1	1812	UTR 3			NP_001182583.1
NM_032527.4	1812	UTR 3			NP_115916.3
NM_181485.2	1812	UTR 3			NP_852150.2

View Full Product Details