Product Details

SNP ID: rs7554597
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 36
Location: Chr.1:177932523 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAGACAAGCCTCCAACCCCAGCGCC[C/T]GCAGCTGCTCCCCCGCTGGATGCGG
Phenotype: MIM: 612855
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: SEC16B PubMed Links
Additional Information: For this assay, SNP(s) [rs3748792] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_033127.2	3069	Silent Mutation	GCA,GCG	A993A	NP_149118.2