Product Details

SNP ID

rs2977677

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.8:91955344 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

CACTTTGAAGAGAAAATAAGATGCA[G/T]TAACACATTAAAAATAGGCAACTTG

Phenotype

MIM: 133435

Polymorphism

G/T, Transversion substitution

Allele Nomenclature

Literature Links

RUNX1T1 PubMed Links

Additional Information

For this assay, SNP(s) [rs77807575] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

RUNX1T1

Gene Name

RUNX1 translocation partner 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198625.1	6977	UTR 3			NP_001185554.1
NM_001198626.1	6977	UTR 3			NP_001185555.1
NM_001198627.1	6977	UTR 3			NP_001185556.1
NM_001198628.1	6977	UTR 3			NP_001185557.1
NM_001198629.1	6977	UTR 3			NP_001185558.1
NM_001198630.1	6977	UTR 3			NP_001185559.1
NM_001198631.1	6977	UTR 3			NP_001185560.1
NM_001198632.1	6977	UTR 3			NP_001185561.1
NM_001198633.1	6977	UTR 3			NP_001185562.1
NM_001198634.1	6977	UTR 3			NP_001185563.1
NM_001198679.1	6977	UTR 3			NP_001185608.1
NM_004349.3	6977	UTR 3			NP_004340.1
NM_175634.2	6977	UTR 3			NP_783552.1
NM_175635.2	6977	UTR 3			NP_783553.1
NM_175636.2	6977	UTR 3			NP_783554.1
XM_006716676.3	6977	UTR 3			XP_006716739.1
XM_011517351.2	6977	UTR 3			XP_011515653.1
XM_011517352.2	6977	UTR 3			XP_011515654.1
XM_011517353.2	6977	UTR 3			XP_011515655.1
XM_017013930.1	6977	UTR 3			XP_016869419.1
XM_017013931.1	6977	UTR 3			XP_016869420.1
XM_017013932.1	6977	UTR 3			XP_016869421.1
XM_017013933.1	6977	UTR 3			XP_016869422.1
XM_017013934.1	6977	UTR 3			XP_016869423.1
XM_017013935.1	6977	UTR 3			XP_016869424.1
XM_017013936.1	6977	UTR 3			XP_016869425.1
XM_017013937.1	6977	UTR 3			XP_016869426.1
XM_017013938.1	6977	Intron			XP_016869427.1
XM_017013939.1	6977	UTR 3			XP_016869428.1
XM_017013940.1	6977	UTR 3			XP_016869429.1
XM_017013941.1	6977	UTR 3			XP_016869430.1

View Full Product Details