Product Details

SNP ID: rs805293
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31720741 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAGTGTGGCAAGAGGAACCAGACC[A/T]GAATAGAATCCTCTCACCCCAGTAG
Phenotype: MIM: 606520 MIM: 602872 MIM: 604744 MIM: 610435 MIM: 606038 MIM: 610437
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: C6orf25 PubMed Links

Gene Details

Gene: C6orf25
Gene Name: chromosome 6 open reading frame 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025260.3	185	Intron			NP_079536.2
NM_138272.2	185	Intron			NP_612116.1
NM_138273.2	185	Intron			NP_612117.1
NM_138274.2	185	Intron			NP_612118.1
NM_138275.2	185	Intron			NP_612119.1
NM_138277.2	185	Intron			NP_612121.1
XM_011514920.2	185	Intron			XP_011513222.1
XM_011514921.2	185	Intron			XP_011513223.1
XM_017011330.1	185	Intron			XP_016866819.1
XM_017011331.1	185	Intron			XP_016866820.1
XM_017011332.1	185	Intron			XP_016866821.1
XM_017011333.1	185	UTR 5			XP_016866822.1

Gene: CLIC1
Gene Name: chloride intracellular channel 1

There are no transcripts associated with this gene.

Gene: DDAH2
Gene Name: dimethylarginine dimethylaminohydrolase 2

There are no transcripts associated with this gene.

Gene: LY6G6C
Gene Name: lymphocyte antigen 6 complex, locus G6C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025261.2	185	Intron			NP_079537.1

Gene: LY6G6D
Gene Name: lymphocyte antigen 6 complex, locus G6D

There are no transcripts associated with this gene.

Gene: LY6G6E
Gene Name: lymphocyte antigen 6 complex, locus G6E (pseudogene)

There are no transcripts associated with this gene.

View Full Product Details