Product Details

SNP ID: rs3087631
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.16:2089126 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGCCCCCAGCACCGGCCCAAGGCCA[A/T]GCTCGCATCCAAGCAGCAGCCGGGC
Phenotype: MIM: 611621 MIM: 601313 MIM: 191092
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: LOC105371049 PubMed Links

Gene Details

Gene: LOC105371049
Gene Name: uncharacterized LOC105371049

There are no transcripts associated with this gene.

Gene: MIR1225
Gene Name: microRNA 1225

There are no transcripts associated with this gene.

Gene: PKD1
Gene Name: polycystin 1, transient receptor potential channel interacting

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000296.3	13747	UTR 3			NP_000287.3
NM_001009944.2	13747	UTR 3			NP_001009944.2
XM_005255370.3	13747	UTR 3			XP_005255427.1
XM_011522528.2	13747	UTR 3			XP_011520830.1
XM_011522529.2	13747	UTR 3			XP_011520831.1
XM_011522530.2	13747	UTR 3			XP_011520832.1
XM_011522532.2	13747	UTR 3			XP_011520834.1
XM_011522534.2	13747	UTR 3			XP_011520836.1
XM_011522535.2	13747	UTR 3			XP_011520837.1
XM_011522537.2	13747	UTR 3			XP_011520839.1
XM_017023285.1	13747	UTR 3			XP_016878774.1

Gene: TSC2
Gene Name: tuberous sclerosis 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000548.4	13747	Intron			NP_000539.2
NM_001077183.2	13747	Intron			NP_001070651.1
NM_001114382.2	13747	Intron			NP_001107854.1
NM_001318827.1	13747	Intron			NP_001305756.1
NM_001318829.1	13747	Intron			NP_001305758.1
NM_001318831.1	13747	Intron			NP_001305760.1
NM_001318832.1	13747	Intron			NP_001305761.1
XM_005255529.4	13747	Intron			XP_005255586.2
XM_005255531.4	13747	Intron			XP_005255588.2
XM_011522636.2	13747	Intron			XP_011520938.1
XM_011522637.2	13747	Intron			XP_011520939.1
XM_011522638.2	13747	Intron			XP_011520940.2
XM_011522639.2	13747	Intron			XP_011520941.1
XM_011522640.2	13747	Intron			XP_011520942.1
XM_017023615.1	13747	Intron			XP_016879104.1
XM_017023616.1	13747	Intron			XP_016879105.1
XM_017023617.1	13747	Intron			XP_016879106.1
XM_017023618.1	13747	Intron			XP_016879107.1

View Full Product Details