Product Details

SNP ID: rs9898876
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7623644 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCTAATGTTTTTGTATTTTTTGCA[G/T]TGACCGGGTTTTGCCCTGTTGCCCA
Phenotype: MIM: 605339 MIM: 611463 MIM: 182205
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: FXR2 PubMed Links

Gene Details

Gene: FXR2
Gene Name: FMR1 autosomal homolog 2

There are no transcripts associated with this gene.

Gene: SAT2
Gene Name: spermidine/spermine N1-acetyltransferase family member 2

There are no transcripts associated with this gene.

Gene: SHBG
Gene Name: sex hormone binding globulin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040.4		Intron			NP_001031.2
NM_001146279.2		Intron			NP_001139751.1
NM_001146280.2		Intron			NP_001139752.1
NM_001146281.2		Intron			NP_001139753.1
NM_001289113.1		Intron			NP_001276042.1
NM_001289114.1		Intron			NP_001276043.1
NM_001289115.1		Intron			NP_001276044.1
NM_001289116.1		Intron			NP_001276045.1

View Full Product Details