Product Details

SNP ID: rs1737961
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:17812074 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCATCAGCTGAAGACACAAAACCC[A/C]GATTATAAATAATTTCATTTTTAAT
Phenotype: MIM: 613486 MIM: 607642 MIM: 184756
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MIR33B PubMed Links

Gene Details

Gene: MIR33B
Gene Name: microRNA 33b

There are no transcripts associated with this gene.

Gene: MIR6777
Gene Name: microRNA 6777

There are no transcripts associated with this gene.

Gene: RAI1
Gene Name: retinoic acid induced 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030665.3	4186	Intron			NP_109590.3
XM_017024025.1	4186	Intron			XP_016879514.1
XM_017024026.1	4186	Intron			XP_016879515.1
XM_017024027.1	4186	Intron			XP_016879516.1
XM_017024028.1	4186	Intron			XP_016879517.1

Gene: SREBF1
Gene Name: sterol regulatory element binding transcription factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005291.2	4186	UTR 3			NP_001005291.1
NM_001321096.2	4186	UTR 3			NP_001308025.1
NM_004176.4	4186	UTR 3			NP_004167.3
XM_005256772.4	4186	UTR 3			XP_005256829.1
XM_017024970.1	4186	UTR 3			XP_016880459.1
XM_017024971.1	4186	UTR 3			XP_016880460.1

View Full Product Details