Product Details

SNP ID: rs1140409
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:64500552 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTCCTATCAGTCATCCTTACCTG[C/A]ACCTCTGTCTTCGACCAACTGAAGC
Phenotype: MIM: 180630 MIM: 604983
Polymorphism: C/A, Transversion substitution
Allele Nomenclature
Literature Links: CEP95 PubMed Links

Gene Details

Gene: CEP95
Gene Name: centrosomal protein 95

There are no transcripts associated with this gene.

Gene: DDX5
Gene Name: DEAD-box helicase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320595.1	1840	Missense Mutation	GCA,TCA	A480S	NP_001307524.1
NM_001320596.1	1840	Missense Mutation	GCA,TCA	A480S	NP_001307525.1
NM_001320597.1	1840	Missense Mutation	GCA,TCA	A480S	NP_001307526.1
NM_004396.4	1840	Missense Mutation	GCA,TCA	A480S	NP_004387.1

Gene: MIR3064
Gene Name: microRNA 3064

There are no transcripts associated with this gene.

Gene: MIR5047
Gene Name: microRNA 5047

There are no transcripts associated with this gene.

Gene: POLG2
Gene Name: DNA polymerase gamma 2, accessory subunit

There are no transcripts associated with this gene.

View Full Product Details