Product Details

SNP ID: rs7942
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:39921211 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGAAAACAGGCCCAGTGACCTCTCC[C/T]GTTCCCTTGGACCCCTGGAAGAGGA
Phenotype: MIM: 611221 MIM: 610075
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GSDMB PubMed Links

Gene Details

Gene: GSDMB
Gene Name: gasdermin B

There are no transcripts associated with this gene.

Gene: LRRC3C
Gene Name: leucine rich repeat containing 3C

There are no transcripts associated with this gene.

Gene: ORMDL3
Gene Name: ORMDL sphingolipid biosynthesis regulator 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320801.1	1836	UTR 3			NP_001307730.1
NM_001320802.1	1836	UTR 3			NP_001307731.1
NM_001320803.1	1836	UTR 3			NP_001307732.1
NM_139280.3	1836	UTR 3			NP_644809.1
XM_017025345.1	1836	UTR 3			XP_016880834.1
XM_017025346.1	1836	UTR 3			XP_016880835.1
XM_017025347.1	1836	UTR 3			XP_016880836.1
XM_017025348.1	1836	UTR 3			XP_016880837.1

View Full Product Details