Product Details

SNP ID: rs4691
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.10:73802158 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GCTGCGGATGAAGAGGGAAATCTCA[C/T]TGGACTAATACATTCCCCTACACCC
Phenotype: MIM: 603268
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NDST2 PubMed Links

Gene Details

Gene: NDST2
Gene Name: N-deacetylase and N-sulfotransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003635.3	3712	UTR 3			NP_003626.1
XM_005270255.3	3712	UTR 3			XP_005270312.1
XM_005270256.3	3712	UTR 3			XP_005270313.1
XM_011540310.2	3712	UTR 3			XP_011538612.1
XM_017016857.1	3712	UTR 3			XP_016872346.1

Gene: ZSWIM8
Gene Name: zinc finger SWIM-type containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242487.1	3712	Intron			NP_001229416.1
NM_001242488.1	3712	Intron			NP_001229417.1
NM_015037.3	3712	Intron			NP_055852.2
XM_005269648.2	3712	Intron			XP_005269705.1
XM_005269653.3	3712	Intron			XP_005269710.1
XM_005269655.3	3712	Intron			XP_005269712.1
XM_006717725.3	3712	Intron			XP_006717788.1
XM_011539544.1	3712	Intron			XP_011537846.1
XM_017015978.1	3712	Intron			XP_016871467.1

Gene: ZSWIM8-AS1
Gene Name: ZSWIM8 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details