Product Details

SNP ID: rs928391
Assay Type: Functionally tested
NCBI dbSNP Submissions: 45
Location: Chr.1:156806925 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCACTAATCAATCATGTGCTTTTTT[C/T]CTGCTGAGTTCAGATATGACCTTAA
Phenotype: MIM: 191315 MIM: 179755 MIM: 604514
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: NTRK1 PubMed Links

Gene Details

Gene: NTRK1
Gene Name: neurotrophic receptor tyrosine kinase 1

There are no transcripts associated with this gene.

Gene: PRCC
Gene Name: papillary renal cell carcinoma (translocation-associated)

There are no transcripts associated with this gene.

Gene: SH2D2A
Gene Name: SH2 domain containing 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001161441.1		Intron			NP_001154913.1
NM_001161442.1		Intron			NP_001154914.1
NM_001161443.1		Intron			NP_001154915.1
NM_001161444.1		Intron			NP_001154916.1
NM_003975.3		Intron			NP_003966.2
XM_006711615.2		Intron			XP_006711678.1
XM_017002762.1		Intron			XP_016858251.1
XM_017002763.1		Intron			XP_016858252.1
XM_017002764.1		Intron			XP_016858253.1
XM_017002765.1		Intron			XP_016858254.1
XM_017002766.1		Intron			XP_016858255.1
XM_017002767.1		Intron			XP_016858256.1

View Full Product Details