Product Details

SNP ID: rs1044823
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:18899585 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTGGGGGTGGGCTCCTGCCCCCA[A/G]AGGGGATGCAGGTGGATGCCGGGTG
Phenotype: MIM: 606919 MIM: 606942 MIM: 602880
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CERS1 PubMed Links

Gene Details

Gene: CERS1
Gene Name: ceramide synthase 1

There are no transcripts associated with this gene.

Gene: COPE
Gene Name: coatomer protein complex subunit epsilon

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_007263.3	1050	UTR 3			NP_009194.2
NM_199442.1	1050	UTR 3			NP_955474.1
NM_199444.1	1050	UTR 3			NP_955476.1
XM_011527655.1	1050	UTR 3			XP_011525957.1
XM_011527656.1	1050	UTR 3			XP_011525958.1

Gene: GDF1
Gene Name: growth differentiation factor 1

There are no transcripts associated with this gene.

View Full Product Details