Product Details
- SNP ID
-
rs641051
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:60202382 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGAGTACACATTTTTAAATAACTTT[C/T]TGATGTTTTTGTATATAGAATGTAT
- Phenotype
-
MIM: 608401
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR6503
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113311751] are located under a probe and SNP(s) [rs112297379] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR6503
- Gene Name
- microRNA 6503
There are no transcripts associated with this gene.
- Gene
- MS4A4E
- Gene Name
- membrane spanning 4-domains A4E
View Full Product Details