Product Details

SNP ID: rs1056971
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:50579010 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTGTTACATACACAGCACGGGGCT[C/T]TGGCCTGCCAGCCATGGGGACCTAC
Phenotype: MIM: 612395 MIM: 601987
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHKB PubMed Links

Gene Details

Gene: CHKB
Gene Name: choline kinase beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005198.4	1577	UTR 3			NP_005189.2

Gene: CHKB-AS1
Gene Name: CHKB antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: CHKB-CPT1B
Gene Name: CHKB-CPT1B readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: CPT1B
Gene Name: carnitine palmitoyltransferase 1B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145134.1	1577	Intron			NP_001138606.1
NM_001145135.1	1577	Intron			NP_001138607.1
NM_001145137.1	1577	Intron			NP_001138609.1
NM_004377.3	1577	Intron			NP_004368.1
NM_152245.2	1577	Intron			NP_689451.1
NM_152246.2	1577	Intron			NP_689452.1

View Full Product Details