Product Details

SNP ID: rs926803
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.14:64511021 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: AATGGTTGATTATGAGGGAGAAGTT[A/C]TAGGTAGCTCCCAAGTAGTCTAGGT
Phenotype: MIM: 616578 MIM: 194541
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC102723809 PubMed Links

Gene Details

Gene: LOC102723809
Gene Name: uncharacterized LOC102723809

There are no transcripts associated with this gene.

Gene: ZBTB1
Gene Name: zinc finger and BTB domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001123329.1		Intron			NP_001116801.1
NM_014950.2		Intron			NP_055765.2
XM_005267410.1		Intron			XP_005267467.1
XM_011536566.2		Intron			XP_011534868.1
XM_011536568.2		Intron			XP_011534870.1
XM_017021094.1		Intron			XP_016876583.1
XM_017021095.1		Intron			XP_016876584.1

Gene: ZBTB25
Gene Name: zinc finger and BTB domain containing 25

There are no transcripts associated with this gene.

View Full Product Details