Product Details

SNP ID

rs288038

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.5:138871844 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GATCGAAATGTATTATATAATAGTT[A/G]GAAAGTGTTTTTTTTCATGGTTCCT

Phenotype

MIM: 116805 MIM: 610868

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

CTNNA1 PubMed Links

Additional Information

For this assay, SNP(s) [rs148797416] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CTNNA1

Gene Name

catenin alpha 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001290307.2	3174	Intron			NP_001277236.1
NM_001290309.2	3174	Intron			NP_001277238.1
NM_001290310.2	3174	Intron			NP_001277239.1
NM_001290312.1	3174	Intron			NP_001277241.1
NM_001323982.1	3174	Intron			NP_001310911.1
NM_001323983.1	3174	Intron			NP_001310912.1
NM_001323984.1	3174	Intron			NP_001310913.1
NM_001323985.1	3174	Intron			NP_001310914.1
NM_001323986.1	3174	Intron			NP_001310915.1
NM_001323987.1	3174	Intron			NP_001310916.1
NM_001323988.1	3174	Intron			NP_001310917.1
NM_001323989.1	3174	Intron			NP_001310918.1
NM_001323990.1	3174	Intron			NP_001310919.1
NM_001323991.1	3174	Intron			NP_001310920.1
NM_001323992.1	3174	Intron			NP_001310921.1
NM_001323993.1	3174	Intron			NP_001310922.1
NM_001323994.1	3174	Intron			NP_001310923.1
NM_001323995.1	3174	Intron			NP_001310924.1
NM_001323996.1	3174	Intron			NP_001310925.1
NM_001323997.1	3174	Intron			NP_001310926.1
NM_001323998.1	3174	Intron			NP_001310927.1
NM_001323999.1	3174	Intron			NP_001310928.1
NM_001324000.1	3174	Intron			NP_001310929.1
NM_001324001.1	3174	Intron			NP_001310930.1
NM_001324002.1	3174	Intron			NP_001310931.1
NM_001324003.1	3174	Intron			NP_001310932.1
NM_001324004.1	3174	Intron			NP_001310933.1
NM_001324005.1	3174	Intron			NP_001310934.1
NM_001324006.1	3174	Intron			NP_001310935.1
NM_001324007.1	3174	Intron			NP_001310936.1
NM_001324008.1	3174	Intron			NP_001310937.1
NM_001324009.1	3174	Intron			NP_001310938.1
NM_001324010.1	3174	Intron			NP_001310939.1
NM_001324011.1	3174	Intron			NP_001310940.1
NM_001324012.1	3174	Intron			NP_001310941.1
NM_001324013.1	3174	Intron			NP_001310942.1
NM_001903.4	3174	Intron			NP_001894.2

Gene

LRRTM2

Gene Name

leucine rich repeat transmembrane neuronal 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015564.2	3174	UTR 3			NP_056379.1

View Full Product Details