Product Details
- SNP ID
-
rs1242330
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
60
- Location
-
Chr.1:52931170 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- AGGAAAGGAAACAATAGCTGAGATA[G/T]ATCGGAAGATTTTTGGAAGATTCTG
- Phenotype
-
MIM: 184755
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ECHDC2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113080929] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ECHDC2
- Gene Name
- enoyl-CoA hydratase domain containing 2
There are no transcripts associated with this gene.
- Gene
- MIR1273F
- Gene Name
- microRNA 1273f
There are no transcripts associated with this gene.
- Gene
- MIR1273G
- Gene Name
- microRNA 1273g
There are no transcripts associated with this gene.
- Gene
- MIR5095
- Gene Name
- microRNA 5095
There are no transcripts associated with this gene.
- Gene
- SCP2
- Gene Name
- sterol carrier protein 2
View Full Product Details