Product Details

SNP ID

rs1801672

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.10:13441189 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GTTATACACCATTTTCACAACCAGG[C/G]TTGCATTGAATTCTTTTTTAAAGAA

Phenotype

Polymorphism

C/G, Transversion Substitution

Allele Nomenclature

Literature Links

BEND7 PubMed Links

Additional Information

For this assay, SNP(s) [rs141062105] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

BEND7

Gene Name

BEN domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001100912.1	3384	UTR 3			NP_001094382.1
NM_152751.2	3384	Intron			NP_689964.2
XM_005252402.4	3384	Intron			XP_005252459.1
XM_011519390.2	3384	Intron			XP_011517692.1
XM_011519391.2	3384	Intron			XP_011517693.1
XM_011519392.2	3384	Intron			XP_011517694.1
XM_011519393.2	3384	Intron			XP_011517695.1
XM_011519394.2	3384	Intron			XP_011517696.1
XM_011519395.2	3384	Intron			XP_011517697.1
XM_011519396.2	3384	Intron			XP_011517698.1
XM_011519397.2	3384	Intron			XP_011517699.1
XM_011519398.2	3384	UTR 3			XP_011517700.1
XM_011519399.2	3384	UTR 3			XP_011517701.1
XM_011519400.2	3384	UTR 3			XP_011517702.1
XM_011519401.2	3384	UTR 3			XP_011517703.1
XM_011519402.2	3384	UTR 3			XP_011517704.1
XM_011519403.2	3384	UTR 3			XP_011517705.1
XM_011519404.2	3384	Intron			XP_011517706.1
XM_011519405.2	3384	UTR 3			XP_011517707.1
XM_011519406.2	3384	Intron			XP_011517708.1
XM_011519407.1	3384	Intron			XP_011517709.1
XM_011519408.2	3384	UTR 3			XP_011517710.1
XM_011519410.2	3384	Intron			XP_011517712.1
XM_011519411.2	3384	UTR 3			XP_011517713.1
XM_011519412.1	3384	Intron			XP_011517714.1
XM_011519413.1	3384	Intron			XP_011517715.1
XM_011519414.1	3384	Intron			XP_011517716.1
XM_017015915.1	3384	Intron			XP_016871404.1
XM_017015916.1	3384	UTR 3			XP_016871405.1
XM_017015917.1	3384	UTR 3			XP_016871406.1
XM_017015918.1	3384	UTR 3			XP_016871407.1
XM_017015919.1	3384	UTR 3			XP_016871408.1

View Full Product Details