Product Details

SNP ID
rs1804849
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.11:64804032 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GCTCTAGGTGAGCGGTTCCGAGGAG[A/G]AGCTTGGGTTTCTAGGGGCTGGGCC
Phenotype
MIM: 603166 MIM: 613733
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
MAP4K2 PubMed Links
Additional Information
For this assay, SNP(s) [rs143341556] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MAP4K2
Gene Name
mitogen-activated protein kinase kinase kinase kinase 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001307990.1 2627 Intron NP_001294919.1
NM_004579.4 2627 Intron NP_004570.2
XM_011545203.2 2627 Intron XP_011543505.1
XM_011545204.2 2627 Intron XP_011543506.1
XM_017018093.1 2627 Intron XP_016873582.1
XM_017018094.1 2627 Intron XP_016873583.1
XM_017018095.1 2627 Intron XP_016873584.1
XM_017018096.1 2627 Intron XP_016873585.1
Gene
MEN1
Gene Name
menin 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_000244.3 2627 UTR 3 NP_000235.2
NM_130799.2 2627 UTR 3 NP_570711.1
NM_130800.2 2627 UTR 3 NP_570712.1
NM_130801.2 2627 UTR 3 NP_570713.1
NM_130802.2 2627 UTR 3 NP_570714.1
NM_130803.2 2627 UTR 3 NP_570715.1
NM_130804.2 2627 UTR 3 NP_570716.1
XM_005274001.4 2627 UTR 3 XP_005274058.1
XM_011545040.1 2627 UTR 3 XP_011543342.1
XM_011545041.2 2627 UTR 3 XP_011543343.1
XM_011545042.2 2627 UTR 3 XP_011543344.1
XM_017017765.1 2627 UTR 3 XP_016873254.1
XM_017017766.1 2627 UTR 3 XP_016873255.1
XM_017017767.1 2627 UTR 3 XP_016873256.1
XM_017017768.1 2627 UTR 3 XP_016873257.1
XM_017017769.1 2627 UTR 3 XP_016873258.1
XM_017017770.1 2627 UTR 3 XP_016873259.1

View Full Product Details