Product Details

SNP ID: rs6928392
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:116533203 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACAGCACTTCTAACAGCAGTCAAA[C/T]AGAGACAGTAGATTTATAGTCATTG
Phenotype: MIM: 614137
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM26D PubMed Links

Gene Details

Gene: FAM26D
Gene Name: family with sequence similarity 26 member D

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256887.2		Intron			NP_001243816.1
NM_001256888.2		Intron			NP_001243817.1
NM_001256889.2		Intron			NP_001243818.1
NM_153036.4		Intron			NP_694581.1
XM_005266860.3		Intron			XP_005266917.1
XM_011535560.2		Intron			XP_011533862.1
XM_011535561.2		Intron			XP_011533863.1
XM_011535562.2		Intron			XP_011533864.1
XM_011535563.2		Intron			XP_011533865.1
XM_011535564.1		Intron			XP_011533866.1
XM_017010390.1		Intron			XP_016865879.1
XM_017010391.1		Intron			XP_016865880.1
XM_017010392.1		Intron			XP_016865881.1

Gene: FAM26E
Gene Name: family with sequence similarity 26 member E

There are no transcripts associated with this gene.

Gene: TRAPPC3L
Gene Name: trafficking protein particle complex 3 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001139444.2		Intron			NP_001132916.1

View Full Product Details