Product Details

SNP ID: rs1618613
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:1948658 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GAGGCAGGCTGGTGGCAGTGAGCCA[A/G]GTTTTTGTGTTTTGAGGAAGAAGTT
Phenotype: MIM: 600789 MIM: 600692
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MRPL23 PubMed Links

Gene Details

Gene: MRPL23
Gene Name: mitochondrial ribosomal protein L23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021134.3		Intron			NP_066957.3
XM_006718271.2		Intron			XP_006718334.1
XM_011520273.1		Intron			XP_011518575.1
XM_011520275.2		Intron			XP_011518577.1
XM_011520276.2		Intron			XP_011518578.1

Gene: SNORD131
Gene Name: small nucleolar RNA, C/D box 131

There are no transcripts associated with this gene.

Gene: TNNT3
Gene Name: troponin T3, fast skeletal type

There are no transcripts associated with this gene.

View Full Product Details