Product Details

SNP ID: rs1473937
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:3627015 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CAAAATTTGGAGGGTAAGTGTATAT[G/T]TTTCTGCAGAGAGGGTCTACAACTT
Phenotype
Polymorphism: G/T, Transversion Substitution
Allele Nomenclature
Literature Links: TRPC2 PubMed Links
Additional Information: For this assay, SNP(s) [rs7109228,rs7123007] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: TRPC2
Gene Name: transient receptor potential cation channel subfamily C member 2, pseudogene

There are no transcripts associated with this gene.