Product Details

SNP ID: rs1049831
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27326518 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGCTGTGATCACAGAAGTCTGTA[A/G]AAAGAGTGGGATCTAAGGAGTCCTG
Phenotype: MIM: 604883 MIM: 137960
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GTF3C2 PubMed Links

Gene Details

Gene: GTF3C2
Gene Name: general transcription factor IIIC subunit 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001035521.2	3636	UTR 3			NP_001030598.1
NM_001318909.1	3636	UTR 3			NP_001305838.1
NM_001521.3	3636	UTR 3			NP_001512.1
XM_005264272.4	3636	UTR 3			XP_005264329.1
XM_011532801.2	3636	UTR 3			XP_011531103.1

Gene: GTF3C2-AS1
Gene Name: GTF3C2 antisense RNA 1

There are no transcripts associated with this gene.

Gene: MPV17
Gene Name: MPV17, mitochondrial inner membrane protein

There are no transcripts associated with this gene.

View Full Product Details