Product Details

SNP ID
rs1053671
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.4:113454256 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AGAGTTGTACTTGGAATATTGTGGA[A/T]TTTTTTTTTTGTCTAATCTCCCCCT
Phenotype
MIM: 607708
Polymorphism
A/T, Transversion Substitution
Allele Nomenclature
Literature Links
CAMK2D PubMed Links
Additional Information
For this assay, SNP(s) [rs202106323] are located under a probe and SNP(s) [rs112087287] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CAMK2D
Gene Name
calcium/calmodulin dependent protein kinase II delta
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001221.3 2594 UTR 3 NP_001212.2
NM_001321566.1 2594 UTR 3 NP_001308495.1
NM_001321567.1 2594 UTR 3 NP_001308496.1
NM_001321568.1 2594 UTR 3 NP_001308497.1
NM_001321569.1 2594 UTR 3 NP_001308498.1
NM_001321570.1 2594 UTR 3 NP_001308499.1
NM_001321571.1 2594 UTR 3 NP_001308500.1
NM_001321572.1 2594 UTR 3 NP_001308501.1
NM_001321573.1 2594 UTR 3 NP_001308502.1
NM_001321574.1 2594 UTR 3 NP_001308503.1
NM_001321575.1 2594 UTR 3 NP_001308504.1
NM_001321576.1 2594 UTR 3 NP_001308505.1
NM_001321577.1 2594 UTR 3 NP_001308506.1
NM_001321578.1 2594 UTR 3 NP_001308507.1
NM_001321579.1 2594 UTR 3 NP_001308508.1
NM_001321580.1 2594 UTR 3 NP_001308509.1
NM_001321581.1 2594 UTR 3 NP_001308510.1
NM_001321582.1 2594 UTR 3 NP_001308511.1
NM_001321583.1 2594 UTR 3 NP_001308512.1
NM_001321584.1 2594 UTR 3 NP_001308513.1
NM_001321585.1 2594 UTR 3 NP_001308514.1
NM_001321586.1 2594 UTR 3 NP_001308515.1
NM_001321587.1 2594 UTR 3 NP_001308516.1
NM_001321588.1 2594 UTR 3 NP_001308517.1
NM_001321589.1 2594 UTR 3 NP_001308518.1
NM_001321590.1 2594 UTR 3 NP_001308519.1
NM_001321591.1 2594 UTR 3 NP_001308520.1
NM_001321592.1 2594 Intron NP_001308521.1
NM_172114.1 2594 Intron NP_742112.1
NM_172115.2 2594 Intron NP_742113.1
NM_172127.2 2594 UTR 3 NP_742125.1
NM_172128.2 2594 UTR 3 NP_742126.1
NM_172129.1 2594 Intron NP_742127.1
XM_005263253.3 2594 UTR 3 XP_005263310.1
XM_005263254.3 2594 UTR 3 XP_005263311.1
XM_006714330.2 2594 UTR 3 XP_006714393.1
XM_011532289.1 2594 UTR 3 XP_011530591.1
XM_011532290.1 2594 UTR 3 XP_011530592.1
XM_011532291.1 2594 UTR 3 XP_011530593.1
XM_011532292.2 2594 UTR 3 XP_011530594.1
XM_011532295.1 2594 UTR 3 XP_011530597.1
XM_017008672.1 2594 UTR 3 XP_016864161.1
XM_017008673.1 2594 UTR 3 XP_016864162.1
XM_017008674.1 2594 UTR 3 XP_016864163.1
XM_017008675.1 2594 UTR 3 XP_016864164.1
XM_017008676.1 2594 UTR 3 XP_016864165.1
XM_017008677.1 2594 UTR 3 XP_016864166.1
XM_017008678.1 2594 UTR 3 XP_016864167.1

View Full Product Details