Product Details

SNP ID
rs1105418
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.11:68482778 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
AATCCTTTTCCATCTTCTGTTGTTA[C/G]TGGTTTTGTGTCTCCTTTCTTGATT
Phenotype
MIM: 610879
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
PPP6R3 PubMed Links
Additional Information
For this assay, SNP(s) [rs76865366] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
PPP6R3
Gene Name
protein phosphatase 6 regulatory subunit 3
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001164160.1 Intron NP_001157632.1
NM_001164161.1 Intron NP_001157633.1
NM_001164162.1 Intron NP_001157634.1
NM_001164163.1 Intron NP_001157635.1
NM_001164164.1 Intron NP_001157636.1
NM_018312.4 Intron NP_060782.2
XM_006718608.3 Intron XP_006718671.1
XM_006718612.3 Intron XP_006718675.1
XM_006718613.2 Intron XP_006718676.1
XM_006718614.2 Intron XP_006718677.1
XM_006718618.3 Intron XP_006718681.1
XM_006718621.2 Intron XP_006718684.1
XM_006718622.3 Intron XP_006718685.1
XM_006718623.3 Intron XP_006718686.1
XM_006718624.2 Intron XP_006718687.1
XM_006718627.3 Intron XP_006718690.1
XM_011545135.1 Intron XP_011543437.1
XM_011545136.2 Intron XP_011543438.1
XM_011545137.2 Intron XP_011543439.1
XM_011545138.2 Intron XP_011543440.1
XM_011545139.1 Intron XP_011543441.1
XM_011545140.2 Intron XP_011543442.1
XM_011545141.1 Intron XP_011543443.1
XM_011545142.2 Intron XP_011543444.1
XM_011545143.1 Intron XP_011543445.1
XM_011545145.2 Intron XP_011543447.1
XM_017017962.1 Intron XP_016873451.1
XM_017017963.1 Intron XP_016873452.1
XM_017017964.1 Intron XP_016873453.1
XM_017017965.1 Intron XP_016873454.1
XM_017017966.1 Intron XP_016873455.1
XM_017017967.1 Intron XP_016873456.1
XM_017017968.1 Intron XP_016873457.1
XM_017017969.1 Intron XP_016873458.1
XM_017017970.1 Intron XP_016873459.1
XM_017017971.1 Intron XP_016873460.1
XM_017017972.1 Intron XP_016873461.1
XM_017017973.1 Intron XP_016873462.1
XM_017017974.1 Intron XP_016873463.1
XM_017017975.1 Intron XP_016873464.1
XM_017017976.1 Intron XP_016873465.1
XM_017017977.1 Intron XP_016873466.1
XM_017017978.1 Intron XP_016873467.1
XM_017017979.1 Intron XP_016873468.1
XM_017017980.1 Intron XP_016873469.1
XM_017017981.1 Intron XP_016873470.1
XM_017017982.1 Intron XP_016873471.1
XM_017017983.1 Intron XP_016873472.1
XM_017017984.1 Intron XP_016873473.1

View Full Product Details