Product Details

SNP ID: rs1008710
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.15:41850194 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: ACAGGTGAGTTAAGAAAGGCTGAGC[C/G]TTTCTTAGGAGGTGGGAAATTCTGG
Phenotype: MIM: 606088 MIM: 605916
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: JMJD7-PLA2G4B PubMed Links

Gene Details

Gene: JMJD7-PLA2G4B
Gene Name: JMJD7-PLA2G4B readthrough

There are no transcripts associated with this gene.

Gene: PLA2G4B
Gene Name: phospholipase A2 group IVB

There are no transcripts associated with this gene.

Gene: SPTBN5
Gene Name: spectrin beta, non-erythrocytic 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016642.3		Intron			NP_057726.4
XM_017022299.1		Intron			XP_016877788.1
XM_017022300.1		Intron			XP_016877789.1
XM_017022301.1		Intron			XP_016877790.1
XM_017022302.1		Intron			XP_016877791.1
XM_017022303.1		Intron			XP_016877792.1
XM_017022304.1		Intron			XP_016877793.1
XM_017022305.1		Intron			XP_016877794.1

View Full Product Details