Product Details

SNP ID: rs1407134
Assay Type: Functionally tested
NCBI dbSNP Submissions: 51
Location: Chr.1:32202008 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCAGCCCAGGCCCCAGGCACACTA[C/T]GGAGGGTCCCTGTGCCTACCAGCCA
Phenotype: MIM: 610162 MIM: 608676
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC28B PubMed Links

Gene Details

Gene: CCDC28B
Gene Name: coiled-coil domain containing 28B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301011.1	1177	Missense Mutation	CGG,TGG	R25W	NP_001287940.1
NM_024296.4	1177	Missense Mutation	CGG,TGG	R25W	NP_077272.2
XM_011542113.2	1177	Missense Mutation	CGG,TGG	R25W	XP_011540415.1
XM_017002306.1	1177	Missense Mutation	CGG,TGG	R25W	XP_016857795.1
XM_017002307.1	1177	Missense Mutation	CGG,TGG	R25W	XP_016857796.1
XM_017002308.1	1177	Missense Mutation	CGG,TGG	R25W	XP_016857797.1
XM_017002309.1	1177	Missense Mutation	CGG,TGG	R25W	XP_016857798.1

Gene: DCDC2B
Gene Name: doublecortin domain containing 2B

There are no transcripts associated with this gene.

Gene: IQCC
Gene Name: IQ motif containing C

There are no transcripts associated with this gene.

Gene: TMEM234
Gene Name: transmembrane protein 234

There are no transcripts associated with this gene.

Gene: TXLNA
Gene Name: taxilin alpha

There are no transcripts associated with this gene.

View Full Product Details