Product Details

SNP ID
rs806109
Assay Type
Functionally Tested
NCBI dbSNP Submissions
40
Location
Chr.1:5992521 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCAATCAGAGCCCAAGTCGAGGGCT[A/G]CGCTTTGCGAGCGCCAGCCAATCGG
Phenotype
MIM: 601142 MIM: 607215
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
KCNAB2 PubMed Links
Additional Information
For this assay, SNP(s) [rs528566414] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
KCNAB2
Gene Name
potassium voltage-gated channel subfamily A regulatory beta subunit 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001199860.1 224 Intron NP_001186789.1
NM_001199861.1 224 UTR 5 NP_001186790.1
NM_001199862.1 224 Intron NP_001186791.1
NM_001199863.1 224 Intron NP_001186792.1
NM_003636.3 224 Intron NP_003627.1
NM_172130.2 224 Intron NP_742128.1
XM_005263514.2 224 Intron XP_005263571.1
XM_011542321.2 224 Intron XP_011540623.1
XM_011542322.2 224 Intron XP_011540624.1
XM_017002618.1 224 Intron XP_016858107.1
XM_017002619.1 224 Intron XP_016858108.1
XM_017002620.1 224 Intron XP_016858109.1
XM_017002621.1 224 Intron XP_016858110.1
Gene
NPHP4
Gene Name
nephronophthisis 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001291593.1 224 Intron NP_001278522.1
NM_001291594.1 224 Intron NP_001278523.1
NM_015102.4 224 Intron NP_055917.1
XM_006710563.3 224 Intron XP_006710626.1
XM_011541213.1 224 Intron XP_011539515.1
XM_011541214.1 224 Intron XP_011539516.1
XM_011541215.1 224 Intron XP_011539517.1
XM_011541216.2 224 Intron XP_011539518.1
XM_011541217.2 224 Intron XP_011539519.1
XM_011541218.2 224 Intron XP_011539520.1
XM_017000996.1 224 Intron XP_016856485.1
XM_017000997.1 224 Intron XP_016856486.1
XM_017000998.1 224 Intron XP_016856487.1
XM_017000999.1 224 Intron XP_016856488.1
XM_017001000.1 224 Intron XP_016856489.1
XM_017001001.1 224 Intron XP_016856490.1
XM_017001002.1 224 Intron XP_016856491.1
XM_017001003.1 224 Intron XP_016856492.1

View Full Product Details