Product Details

SNP ID: rs936229
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:74839978 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTCCCTCCCTGGACTATGCTCCT[A/G]GGAAGGCTGGGCCTGGCTCTGCTTT
Phenotype: MIM: 609585 MIM: 606912 MIM: 613472
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CPLX3 PubMed Links

Gene Details

Gene: CPLX3
Gene Name: complexin 3

There are no transcripts associated with this gene.

Gene: MIR6882
Gene Name: microRNA 6882

There are no transcripts associated with this gene.

Gene: SCAMP2
Gene Name: secretory carrier membrane protein 2

There are no transcripts associated with this gene.

Gene: ULK3
Gene Name: unc-51 like kinase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099436.3		Intron			NP_001092906.3
NM_001284364.2		Intron			NP_001271293.2
NM_001284365.2		Intron			NP_001271294.1
XM_005254289.2		Intron			XP_005254346.1
XM_017022068.1		Intron			XP_016877557.1
XM_017022069.1		Intron			XP_016877558.1
XM_017022070.1		Intron			XP_016877559.1
XM_017022071.1		Intron			XP_016877560.1
XM_017022072.1		Intron			XP_016877561.1

View Full Product Details