Product Details

SNP ID: rs1060897
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:64012196 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAATTCTTTCTTTACAATTTTATGG[A/G]TGTTCGAAATTTAAAAAATACTAGA
Phenotype: MIM: 607640
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATXN7 PubMed Links

Gene Details

Gene: ATXN7
Gene Name: ataxin 7

There are no transcripts associated with this gene.

Gene: PSMD6
Gene Name: proteasome 26S subunit, non-ATPase 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001271779.1		Intron			NP_001258708.1
NM_001271780.1		Intron			NP_001258709.1
NM_001271781.1		Intron			NP_001258710.1
NM_014814.2		Intron			NP_055629.1
XM_005265619.1		Intron			XP_005265676.1
XM_011534288.1		Intron			XP_011532590.1
XM_017007569.1		Intron			XP_016863058.1

Gene: PSMD6-AS2
Gene Name: PSMD6 antisense RNA 2

There are no transcripts associated with this gene.

View Full Product Details