Product Details

SNP ID: rs1054352
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:56525914 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATTCAATACCTTAATGGAACTCGA[A/G]GTGGAGCTTATGAAATTTGTGTCCA
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAM209A PubMed Links

Gene Details

Gene: FAM209A
Gene Name: family with sequence similarity 209 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001012971.3	440	Silent Mutation	GAA,GAG	E120E	NP_001012989.2

Gene: FAM209B
Gene Name: family with sequence similarity 209 member B

There are no transcripts associated with this gene.

Gene: GCNT7
Gene Name: glucosaminyl (N-acetyl) transferase family member 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_080615.1	440	UTR 5			NP_542182.1

Gene: RTFDC1
Gene Name: replication termination factor 2 domain containing 1

There are no transcripts associated with this gene.

View Full Product Details