Product Details

SNP ID: rs1442849
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:8120803 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GCCCGCTACCTCTACCTGGCTTGGC[C/T]TCTGAGATCCAAACCGCGCCCTCCT
Phenotype: MIM: 607206 MIM: 608059 MIM: 610407
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ALOXE3 PubMed Links

Gene Details

Gene: ALOXE3
Gene Name: arachidonate lipoxygenase 3

There are no transcripts associated with this gene.

Gene: HES7
Gene Name: hes family bHLH transcription factor 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001165967.1	3063	UTR 3			NP_001159439.1
NM_032580.3	3063	UTR 3			NP_115969.2
XM_011524041.2	3063	Intron			XP_011522343.1
XM_017025232.1	3063	UTR 3			XP_016880721.1

Gene: TRG-GCC2-6
Gene Name: transfer RNA-Gly (GCC) 2-6

There are no transcripts associated with this gene.

View Full Product Details