Product Details

SNP ID: rs1105627
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:81933937 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GTGCCTGGATGTTGCTGCGTGTCCT[A/G]CTGGTCTAACTTAATCCCACAGCGA
Phenotype: MIM: 602020 MIM: 179035
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MAFG PubMed Links

Gene Details

Gene: MAFG
Gene Name: MAF bZIP transcription factor G

There are no transcripts associated with this gene.

Gene: MAFG-AS1
Gene Name: MAFG antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: MYADML2
Gene Name: myeloid associated differentiation marker like 2

There are no transcripts associated with this gene.

Gene: PYCR1
Gene Name: pyrroline-5-carboxylate reductase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001282279.1		Intron			NP_001269208.1
NM_001282280.1		Intron			NP_001269209.1
NM_001282281.1		Intron			NP_001269210.1
NM_006907.3		Intron			NP_008838.2
NM_153824.2		Intron			NP_722546.1
XM_005256381.2		Intron			XP_005256438.1
XM_011523583.2		Intron			XP_011521885.1
XM_011523584.2		Intron			XP_011521886.1
XM_011523585.2		Intron			XP_011521887.1
XM_017024909.1		Intron			XP_016880398.1

View Full Product Details