Product Details
- SNP ID
-
rs1133965
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:5695200 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AATCCTTGCATCTAAAGGCCTTGTG[G/T]TTTAAAAAAAAAAAGCAAACTTTTT
- Phenotype
-
MIM: 600898
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
LINC01248
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs569083897] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LINC01248
- Gene Name
- long intergenic non-protein coding RNA 1248
There are no transcripts associated with this gene.
- Gene
- SOX11
- Gene Name
- SRY-box 11
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_003108.3 |
2534 |
UTR 3 |
|
|
NP_003099.1 |
View Full Product Details