Product Details

SNP ID: rs1049728
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65653646 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTAGTTCAGAGTAGAAAGAGCAAGA[C/G]TCCAAGTGCTTTGATTGTTCAGTAA
Phenotype: MIM: 164014 MIM: 602180
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: MIR4489 PubMed Links

Gene Details

Gene: MIR4489
Gene Name: microRNA 4489

There are no transcripts associated with this gene.

Gene: RELA
Gene Name: RELA proto-oncogene, NF-kB subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145138.1	2296	UTR 3			NP_001138610.1
NM_001243984.1	2296	UTR 3			NP_001230913.1
NM_001243985.1	2296	UTR 3			NP_001230914.1
NM_021975.3	2296	UTR 3			NP_068810.3
XM_011545206.1	2296	UTR 3			XP_011543508.1
XM_011545207.1	2296	UTR 3			XP_011543509.1

Gene: SIPA1
Gene Name: signal-induced proliferation-associated 1

There are no transcripts associated with this gene.

View Full Product Details