Product Details

SNP ID: rs2236189
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63244297 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCGGACGCACCCCTGCCTTCCACCC[C/G]ACCCCACTCAACTGGGTAGGGGGCA
Phenotype: MIM: 605737 MIM: 612873
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: BIRC7 PubMed Links

Gene Details

Gene: BIRC7
Gene Name: baculoviral IAP repeat containing 7

There are no transcripts associated with this gene.

Gene: FLJ16779
Gene Name: uncharacterized LOC100192386

There are no transcripts associated with this gene.

Gene: LOC107985425
Gene Name: uncharacterized LOC107985425

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017028201.1		Intron			XP_016883690.1

Gene: MIR3196
Gene Name: microRNA 3196

There are no transcripts associated with this gene.

Gene: NKAIN4
Gene Name: Na+/K+ transporting ATPase interacting 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152864.3		Intron			NP_690603.3
XM_005260192.1		Intron			XP_005260249.1
XM_005260194.3		Intron			XP_005260251.1
XM_011528527.1		Intron			XP_011526829.1
XM_011528528.2		Intron			XP_011526830.1
XM_011528529.2		Intron			XP_011526831.1
XM_017027636.1		Intron			XP_016883125.1
XM_017027637.1		Intron			XP_016883126.1
XM_017027638.1		Intron			XP_016883127.1
XM_017027639.1		Intron			XP_016883128.1

View Full Product Details