Product Details

SNP ID: rs35995150
Assay Type: Validated
NCBI dbSNP Submissions: 35
Location: Chr.1:112722308 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: CACTGTGCCTGGCCTGGCTGTGGAC[C/G]CACCTGACCTTGGCTGCCTTGCAGC
Phenotype: MIM: 609957
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: FAM19A3 PubMed Links

Gene Details

Gene: FAM19A3
Gene Name: family with sequence similarity 19 member A3, C-C motif chemokine like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001004440.1	431	Silent Mutation	ACC,ACG	T25T	NP_001004440.1
NM_182759.2	431	Silent Mutation	ACC,ACG	T25T	NP_877436.1
XM_005270766.3	431	Silent Mutation	ACC,ACG	T25T	XP_005270823.1
XM_006710582.3	431	Silent Mutation	ACC,ACG	T25T	XP_006710645.1

Gene: LOC105378910
Gene Name: uncharacterized LOC105378910

There are no transcripts associated with this gene.

Gene: PPM1J
Gene Name: protein phosphatase, Mg2+/Mn2+ dependent 1J

There are no transcripts associated with this gene.

View Full Product Details