Product Details

SNP ID: rs10902227
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:845789 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCTCGGTGGTCCCAGGAGGAAAGA[C/T]TGGGGGACCTCTGGACTATCTGTCC
Phenotype: MIM: 602243 MIM: 601189 MIM: 602644
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CD151 PubMed Links

Gene Details

Gene: CD151
Gene Name: CD151 molecule (Raph blood group)

There are no transcripts associated with this gene.

Gene: POLR2L
Gene Name: RNA polymerase II subunit L

There are no transcripts associated with this gene.

Gene: TSPAN4
Gene Name: tetraspanin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001025234.1		Intron			NP_001020405.1
NM_001025235.1		Intron			NP_001020406.1
NM_001025236.1		Intron			NP_001020407.1
NM_001025237.1		Intron			NP_001020408.1
NM_001025238.1		Intron			NP_001020409.1
NM_001025239.1		Intron			NP_001020410.1
NM_003271.4		Intron			NP_003262.1
XM_005253102.1		Intron			XP_005253159.1
XM_005253104.1		Intron			XP_005253161.1
XM_011520336.1		Intron			XP_011518638.1
XM_011520337.2		Intron			XP_011518639.1
XM_011520338.1		Intron			XP_011518640.1
XM_011520339.2		Intron			XP_011518641.1
XM_011520340.2		Intron			XP_011518642.1
XM_011520341.2		Intron			XP_011518643.1

View Full Product Details