Product Details

SNP ID

rs5753659

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.22:31497627 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

GGCCCCTAAGTGTTCAGTGAAAGGA[A/G]GAGTTCCATGTCTCTCACTTTATAT

Phenotype

MIM: 607445 MIM: 612765

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

EIF4ENIF1 PubMed Links

Additional Information

For this assay, SNP(s) [rs111281097] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

EIF4ENIF1

Gene Name

eukaryotic translation initiation factor 4E nuclear import factor 1

There are no transcripts associated with this gene.

Gene

SFI1

Gene Name

SFI1 centrin binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001007467.2		Intron			NP_001007468.1
NM_001258325.1		Intron			NP_001245254.1
NM_001258326.1		Intron			NP_001245255.1
NM_001258327.1		Intron			NP_001245256.1
NM_014775.3		Intron			NP_055590.2
XM_005261868.2		Intron			XP_005261925.1
XM_006724390.2		Intron			XP_006724453.1
XM_011530570.2		Intron			XP_011528872.1
XM_011530571.2		Intron			XP_011528873.1
XM_011530574.2		Intron			XP_011528876.1
XM_011530575.2		Intron			XP_011528877.1
XM_011530576.2		Intron			XP_011528878.1
XM_011530577.2		Intron			XP_011528879.1
XM_011530579.2		Intron			XP_011528881.1
XM_011530580.2		Intron			XP_011528882.1
XM_011530581.2		Intron			XP_011528883.1
XM_011530582.2		Intron			XP_011528884.1
XM_011530583.2		Intron			XP_011528885.1
XM_011530587.2		Intron			XP_011528889.1
XM_017029139.1		Intron			XP_016884628.1
XM_017029140.1		Intron			XP_016884629.1
XM_017029141.1		Intron			XP_016884630.1
XM_017029142.1		Intron			XP_016884631.1
XM_017029143.1		Intron			XP_016884632.1
XM_017029144.1		Intron			XP_016884633.1
XM_017029145.1		Intron			XP_016884634.1
XM_017029146.1		Intron			XP_016884635.1
XM_017029147.1		Intron			XP_016884636.1
XM_017029148.1		Intron			XP_016884637.1
XM_017029149.1		Intron			XP_016884638.1
XM_017029150.1		Intron			XP_016884639.1
XM_017029151.1		Intron			XP_016884640.1
XM_017029152.1		Intron			XP_016884641.1
XM_017029153.1		Intron			XP_016884642.1
XM_017029154.1		Intron			XP_016884643.1
XM_017029155.1		Intron			XP_016884644.1
XM_017029156.1		Intron			XP_016884645.1
XM_017029157.1		Intron			XP_016884646.1
XM_017029158.1		Intron			XP_016884647.1
XM_017029159.1		Intron			XP_016884648.1
XM_017029160.1		Intron			XP_016884649.1
XM_017029161.1		Intron			XP_016884650.1
XM_017029162.1		Intron			XP_016884651.1

View Full Product Details