Product Details

SNP ID: rs12448948
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.16:25700666 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GCATAATGGATGATCTCTCTGGAAT[A/G]GATTGAACCACCGCCCCGTTCAAGT
Phenotype: MIM: 604059
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: HS3ST4 PubMed Links
Additional Information: For this assay, SNP(s) [rs115717481] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006040.2		Intron			NP_006031.2