Product Details

SNP ID: rs4727672
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:78347546 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTTGGGGTGGTTGTGAGGATTAAG[C/T]GAAATAATGAATATTAGCACATGGT
Phenotype: MIM: 606382
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MAGI2 PubMed Links

Gene Details

Gene: MAGI2
Gene Name: membrane associated guanylate kinase, WW and PDZ domain containing 2

Transcript Accession	SNP Type	Protein ID
NM_001301128.1	Intron	NP_001288057.1
NM_012301.3	Intron	NP_036433.2
XM_011516718.1	Intron	XP_011515020.1
XM_011516719.2	Intron	XP_011515021.1
XM_011516720.2	Intron	XP_011515022.1
XM_011516726.2	Intron	XP_011515028.1
XM_011516728.1	Intron	XP_011515030.1
XM_017012840.1	Intron	XP_016868329.1
XM_017012841.1	Intron	XP_016868330.1
XM_017012842.1	Intron	XP_016868331.1
XM_017012843.1	Intron	XP_016868332.1
XM_017012844.1	Intron	XP_016868333.1
XM_017012845.1	Intron	XP_016868334.1
XM_017012846.1	Intron	XP_016868335.1
XM_017012847.1	Intron	XP_016868336.1
XM_017012848.1	Intron	XP_016868337.1
XM_017012849.1	Intron	XP_016868338.1
XM_017012850.1	Intron	XP_016868339.1
XM_017012851.1	Intron	XP_016868340.1
XM_017012852.1	Intron	XP_016868341.1

There are no transcripts associated with this gene.