Product Details

SNP ID: rs7465214
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:143835363 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGCATGCTGAGGAGGCAGTGGCCCC[A/G]GCCAGGCAGCCTGGGTAGGAACTCA
Phenotype: MIM: 615563 MIM: 604819
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6845 PubMed Links

Gene Details

Gene: MIR6845
Gene Name: microRNA 6845

There are no transcripts associated with this gene.

Gene: NRBP2
Gene Name: nuclear receptor binding protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_178564.3	2036	UTR 3			NP_848659.2
XM_017013378.1	2036	Intron			XP_016868867.1
XM_017013379.1	2036	Intron			XP_016868868.1
XM_017013380.1	2036	UTR 3			XP_016868869.1
XM_017013381.1	2036	Intron			XP_016868870.1
XM_017013382.1	2036	Intron			XP_016868871.1
XM_017013383.1	2036	UTR 3			XP_016868872.1

Gene: PUF60
Gene Name: poly(U) binding splicing factor 60

There are no transcripts associated with this gene.

View Full Product Details