Product Details

SNP ID
rs6502055
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.17:82112992 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
GAAGTGAGTGCCAGCCGTTGTGTGG[G/T]CATAGAATAAATATTATCAGAAAGT
Phenotype
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
CCDC57 PubMed Links
Additional Information
For this assay, SNP(s) [rs8075120] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CCDC57
Gene Name
coiled-coil domain containing 57
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001316321.1 2711 Intron NP_001303250.1
NM_198082.2 2711 Intron NP_932348.2
XM_011523545.2 2711 UTR 3 XP_011521847.2
XM_011523546.2 2711 UTR 3 XP_011521848.1
XM_011523548.2 2711 UTR 3 XP_011521850.1
XM_011523549.2 2711 UTR 3 XP_011521851.1
XM_011523551.2 2711 UTR 3 XP_011521853.1
XM_011523552.2 2711 UTR 3 XP_011521854.1
XM_011523555.2 2711 UTR 3 XP_011521857.1
XM_011523556.2 2711 Intron XP_011521858.2
XM_011523557.2 2711 UTR 3 XP_011521859.1
XM_017024462.1 2711 UTR 3 XP_016879951.1
XM_017024463.1 2711 Intron XP_016879952.1
XM_017024464.1 2711 Intron XP_016879953.1
XM_017024465.1 2711 UTR 3 XP_016879954.1
XM_017024466.1 2711 Intron XP_016879955.1
XM_017024467.1 2711 UTR 3 XP_016879956.1
XM_017024468.1 2711 Intron XP_016879957.1
XM_017024469.1 2711 UTR 3 XP_016879958.1
XM_017024470.1 2711 UTR 3 XP_016879959.1
XM_017024471.1 2711 UTR 3 XP_016879960.1
XM_017024472.1 2711 UTR 3 XP_016879961.1
XM_017024473.1 2711 Intron XP_016879962.1
XM_017024474.1 2711 Intron XP_016879963.1
XM_017024475.1 2711 UTR 3 XP_016879964.1
XM_017024476.1 2711 UTR 3 XP_016879965.1
XM_017024477.1 2711 UTR 3 XP_016879966.1
XM_017024478.1 2711 UTR 3 XP_016879967.1
XM_017024479.1 2711 Intron XP_016879968.1
XM_017024480.1 2711 Intron XP_016879969.1
XM_017024481.1 2711 Intron XP_016879970.1
XM_017024482.1 2711 Intron XP_016879971.1
XM_017024483.1 2711 Intron XP_016879972.1

View Full Product Details