Product Details

SNP ID: rs371248
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.21:44602031 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTGTGGGGAGAAATGAGGGTAGACA[C/G]GTACCAACTGGGTTTCTCGTCACTG
Phenotype: MIM: 612920
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: KRTAP10-6 PubMed Links

Gene Details

Gene: KRTAP10-6
Gene Name: keratin associated protein 10-6

There are no transcripts associated with this gene.

Gene: KRTAP10-7
Gene Name: keratin associated protein 10-7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198689.2	1435	UTR 3			NP_941962.1

Gene: TSPEAR
Gene Name: thrombospondin type laminin G domain and EAR repeats

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272037.1	1435	Intron			NP_001258966.1
NM_144991.2	1435	Intron			NP_659428.2

View Full Product Details